Follow

Keep Up to Date with the Most Important News

By pressing the Subscribe button, you confirm that you have read and are agreeing to our Privacy Policy and Terms of Use
Contact

Finding the complementry strand of DNA

I’m given the following DNA string:

mydna = 'AGUGGCUAUUACUACAUGCCGAAGUUCCUUAAAUUUAACUUACCAGGCUUAACCGGAUGAUGAUUAUUAUUACCUUAAUUUUA'

How can I get the DNA string’s complement?

MEDevel.com: Open-source for Healthcare and Education

Collecting and validating open-source software for healthcare, education, enterprise, development, medical imaging, medical records, and digital pathology.

Visit Medevel

>Solution :

No fancy stuff:

original_strand = 'AGUGGCUAUUACUACAUGCCGAAGUUCCUUAAAUUUAACUUACCAGGCUUAACCGGAUGAUGAUUAUUAUUACCUUAAUUUUA'
new_strand = ''

for char in original_strand: # for every character in the string...
    if char == 'A':
        replace_with = 'U'
    elif char == 'U':
        replace_with = 'A'
    elif char == 'C':
        replace_with = 'G'
    elif char == 'G':
        replace_with = 'C'

    new_strand += replace_with

print(new_strand)
Add a comment

Leave a Reply

Keep Up to Date with the Most Important News

By pressing the Subscribe button, you confirm that you have read and are agreeing to our Privacy Policy and Terms of Use

Discover more from Dev solutions

Subscribe now to keep reading and get access to the full archive.

Continue reading