The task is: Write a script (call it what you want) that that can analyze a fastafile (MySequences.fasta) by finding the reverse complement of the sequences. Using python. from itertools import repeat #opening file filename = "MySequences.fasta" file = open(filename, ‘r’) #reading the file for line in file: line = line.strip() if ">" in line:… Read More Reverse complement from a file
The task is: Write a script (call it what you want) that that can analyze a fastafile (MySequences.fasta) by finding the reverse complement of the sequences. Using python. from itertools import repeat #opening file filename = "MySequences.fasta" file = open(filename, ‘r’) #reading the file for line in file: line = line.strip() if ">" in line:… Read More Reverse complement from a file
I have a python code and I’m working with a list of sequences seq0,seq1,seq2,seq3,seq4,seq5 = ‘CCACGCGTCCGCCGCGACCTGCGTTTTCCTGGGGGTCCGCAACTCTGGCTTGACCCAAGGACCCGGCCAC’,’attgccattatataACCCGGCCACCCCCATAGGCAGATGTCAGGACAACTCGCATCTCAGCAGAGCAGCCCCTGGCCCAGG’,’TCXCACCCATAGGCAGATGGCCTCCGCCCCACCCCCGGGAGGATTTCTTAATGGGGTGAAAATGC’,’CAGTCCCCGAAGCCAGGGTTCCGGGACCCCCGGGGCCGAGCTGGGCGCGGGAAAAGAAttacggacttaGTCAGCCCCGCAGGGG’,’ATGGGGTGATCGTCGCTCGCGGGCTCTGTCTTCCTGTTCACCCTCCTCTGCCCCCAACTCCATCTCTGAGACCTCCTGCCCCCCCA’,’AAAAAAGAAGTCGCTCGCGTCGCTCGCGGGCTGGGCTCTGTCTGCGTCGCTCGCGGGCTAGAGAGCCAGGGTGA’ NTs = [seq0,seq1,seq2,seq3,seq4,seq5] nucleotides = [‘G’,’A’,’C’,’T’, ‘U’] if any(x not in nucleotides for x in NTs): print("ERROR: non-nucleotide characters present") so this works so far and it does tell me if there are non-nucleotide characters present, but I also… Read More Removing characters from a list of strings if they don't follow a list
I am doing a bioinformatics course and I am trying to write a function to find all occurrences of a substring within a string. def find_match(s, t): """Returns a list of all positions of a substring t in string s. Takes two arguments: s & t. """ occurrences = [] for i in range(len(s)-len(t)+1): #… Read More Creating a list of positions of a substring within a string (DNA) (Python 3)
I have a data frame that contains a long list of entries. I’ve indexed them by protein accession numbers. The problem is, they are repeating because some of the proteins consist of multiple domains. I want to make the protein accession numbers the main entries (and it’d have information about how many domains it has… Read More structure of the dataframe
First time posting here so please be patient! I have a file that looks like that: POS {ALLELE:COUNT} 1 G:27 A:11 2 C:40 T:0 3 C:40 A:0 4 T:40 G:0 5 G:0 C:40 6 C:40 T:0 7 G:24 A:14 8 G:40 A:0 9 A:40 G:0 … I want to combine the information from the second… Read More Change format and combine info from 2 columns
I have a BAM file from which I need to extract the two words starting with "PL:Z…", followed by "PR:Z…" I started trying with the first word, but no luck : samtools view -h file1.bam | grep -o ‘\<PR[[:alnum:]]+\>’ Extracting columns with awk would have been easier, however, I observed that the column numbers for… Read More using grep (or awk) to extract two consecutive words
I have a file that looks like this: Sample_ID Population CP026243.1_309 CP026243.1_318 CP026243.1_427 CP026243.1_449 CP026243.1_515 Turbot-BalticSea_01 BalticSea 0 0 0 Turbot-BalticSea_02 BalticSea -1 -1 -1 Turbot-BalticSea_03 BalticSea -1 -1 0 Turbot-BalticSea_04 BalticSea 0 0 -1 Turbot-BalticSea_05 BalticSea -1 -1 0 Turbot-BalticSea_06 BalticSea -1 0 0 Turbot-BalticSea_07 BalticSea -1 -1 -1 Turbot-BalticSea_08 BalticSea 0 0 0… Read More Counting Pattern Per Column From Line X to Y Using AWK