Creating a list of positions of a substring within a string (DNA) (Python 3)

I am doing a bioinformatics course and I am trying to write a function to find all occurrences of a substring within a string.

def find_match(s, t):
  """Returns a list of all positions of a substring t in string s.

  Takes two arguments: s & t.
  """
  occurrences = []
  for i in range(len(s)-len(t)+1): # loop over alignment
    match = True
    for j in range(len(t)): # loop over characters
            if s[i+j] != t[j]:  # compare characters
                match = False   # mismatch
                break
            if match:   # allchars matched
                occurrences.append(i)

  return(occurrences)
    

print(find_match("GATATATGCATATACTT", "ATAT")) # [1, 1, 1, 1, 3, 3, 3, 3, 5, 5, 9, 9, 9, 9, 11, 11, 11, 13]
print(find_match("AUGCUUCAGAAAGGUCUUACG", "U")) # [1, 4, 5, 14, 16, 17]

The output above should exactly match the following:

[2, 4, 10]

[2, 5, 6, 15, 17, 18]

How can I fix this? Preferably without using regular expressions.

>Solution :

It looks like you badly indented the code, the

if match:

has to be outside of the inner cycle.

def find_match(s, t):
    """Returns a list of all positions of a substring t in string s.

      Takes two arguments: s & t.
    """
    occurrences = []
    for i in range(len(s)-len(t)+1): # loop over alignment
        match = True
        for j in range(len(t)): # loop over characters
            if s[i+j] != t[j]:  # compare characters
                match = False   # mismatch
                break
        if match: # <--- This shouldn't be inside the inner for cycle
            occurrences.append(i + 1)

    return occurrences
    

print(find_match("GATATATGCATATACTT", "ATAT")) # [1, 1, 1, 1, 3, 3, 3, 3, 5, 5, 9, 9, 9, 9, 11, 11, 11, 13]
print(find_match("AUGCUUCAGAAAGGUCUUACG", "U")) # [1, 4, 5, 14, 16, 17]